Ttc11/fis1
Web(ab156865) Anti-TTC11/FIS1 antibody [EPR8412] - Abcam - CiteAb. 16 citations – A rabbit monoclonal antibody, raised against Mitochondrial fission 1 protein (Human), supplied by Abcam. ... FIS1 homolog, Tetratricopeptide repeat protein 11, FIS1_HUMAN. UniProt Code History Q9BTP3, Q9Y3D6. Gene Synonyms FIS1, TTC11, CGI-135. WebReactivity. Human (14583) Mouse (12903) Rat (10654) Other (Wide Range) (163) Monkey (43) SARS-CoV-2 (36) Species independent (29) Arabidopsis thaliana (25) Oryza sativa (11) Pig (
Ttc11/fis1
Did you know?
WebAnti-TTC11/FIS1 antibody (ab286127) Datasheet. SDS. Submit a review Submit a question. $670 Product size. 100 µg. Add to basket. The lead time on this item is currently 1-2 … WebFIS1 - fission, mitochondrial 1. The balance between fission and fusion regulates the morphology of mitochondria. TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]). [supplied by OMIM, Mar 2008] Genes similar to FIS1.
WebBrowse FIS1 products, learn FIS1 Information And Facts common name: TTC11. Involved from the fragmentation of the mitochondrial system and its perinuclear clustering. Plays a … WebCompare Fis1 Mouse qPCR Template Standard (NM_025562) from OriGene Technologies on Biocompare.com. Welcome Guest. Sign In Register. Products. Popular Categories; ... Ttc11; Primer Type Gene-specific Primers; Add to Compare List. OriGene Technologies. 9620 Medical Center Drive # 200 Rockville, Maryland 20850.
WebCGI135; FIS1; hFis1; TTC 11; Immunogen. A synthesized peptide derived from human TTC11. Storage. Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Store at +4°C short term. Store at -20°C long term. Avoid freeze / thaw cycle. Purification. WebFIS1 - Explore an overview of FIS1, with a histogram displaying coding mutations, full tabulated details of all associated variants, tissue distribution and any drug resistance data. ... CGI-135, Fis1, H_NH0132A01.6, TTC11, CCDS43626.1, Q9Y3D6, ENSG00000214253.8, NM_016068.2, NP_057152 COSMIC-3D.
WebFeb 4, 2024 · Western Blot: TTC11 Antibody (9810) [NBP2-43628] - Various whole cell extracts (30 ug) were separated by 15% SDS-PAGE, and the membrane was blotted with FIS1 antibody [9810] diluted at 1:500. The HRP-conjugated anti-mouse IgG antibody (NBP2-19382) was used to detect the primary antibody.
WebTTSEC You Invest. We protect. Everyone Benefits! green machine landscaping perthWebAll lanes : Anti-TTC11/FIS1 antibody [EPR8412] (ab156865) at 1/10000 dilution (Purified) Lane 1 : Jurkat (Human T cell leukemia T lymphocyte) whole cell lysate Lane 2 : Raji … green machine lawn care acworthWebFIS1 (a.k.a. CGI-135, TTC11) Cloning Information Cloning method Gibson Cloning 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG 3′ sequencing primer ATAGCGTAAAAGGAGCAACA (Common Sequencing Primers) Terms and Licenses. Academic/Nonprofit Terms. UBMTA; Institut Pasteur Label License for ... flying insect with long tailWebFis1, a 17KDa integral membrane protein, is a novel member of mitochondrial fission machinery. It consists of a central leucine-zipper domain, a coiled-coil region, a … green machine lawn care jacksonville ncWebMar 6, 2024 · Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections) analysis of human kidney tissue sections labeling TTC11/FIS1 with Purified ab156865 at … green machine is in reference to whatWebBiorbyt's Anti-FIS1/APC is a Rabbit Polyclonal antibody. This antibody has been shown to work in applications such as: ... Ttc11, CGI-135; Clonality Polyclonal; Add to Compare List. Biorbyt. 5 Orwell Furlong Cowley Road Cambridge, Cambridgeshire CB4 0WY. United Kingdom Phone: +44(0)1223 815 212 +44(0)1223 280 240 (fax) flying insect with black and white stripesWebBoster Bio Anti-TTC11/FIS1 Antibody Picoband™ catalog # A01932-3. Tested in ELISA, IF, IHC, ICC, WB applications. This antibody reacts with Human, Rat. green machine jelly serum